View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10268_low_8 (Length: 309)

Name: NF10268_low_8
Description: NF10268
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10268_low_8
NF10268_low_8
[»] chr3 (1 HSPs)
chr3 (257-307)||(33328424-33328474)


Alignment Details
Target: chr3 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 257 - 307
Target Start/End: Complemental strand, 33328474 - 33328424
Alignment:
257 tgaaatattatgtactcaagatccacgcgtatgcatcttcttctctctcga 307  Q
    |||||||||||||||||||||||||||| ||||||||||||| ||| ||||    
33328474 tgaaatattatgtactcaagatccacgcatatgcatcttcttttctgtcga 33328424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University