View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_14 (Length: 311)
Name: NF10269_low_14
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 307
Target Start/End: Original strand, 42815861 - 42816167
Alignment:
| Q |
1 |
ttgcttctgctgttccacatgctccaaggctcaactggaatgaatcttcttcaatctgtacctcatgggttggtgtgacttgcaactcaaaccatactcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42815861 |
ttgcttctgctgttccacatgctccaaggctcaactggaacgaatcttcttcaatctgtacctcatgggttggtgtgacttgcaactcaaatcatactcg |
42815960 |
T |
|
| Q |
101 |
tgtcgtaggcatccatcttccaggaattggactaaccggttcgattccggagaacacaataggaaaactagatgctctaagagttctcagtcttcattcc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42815961 |
tgtcgtaggtatccatcttccaggaattggactaaccggttcgattccggagaacacaataggaaaactagatgctctaagagttctcagtcttcattcc |
42816060 |
T |
|
| Q |
201 |
aatggtcttggagggaacctgccttctaacatcctctcaattccttcactccaatttgcacacctgcagaaaaacaacttctcaggtctaattccttctt |
300 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42816061 |
aatggtcttggagggaaccttccttctaacatcctctcaattccttcactccaatttgcacacctgcagaaaaacaacttctcaggtctaattccttctt |
42816160 |
T |
|
| Q |
301 |
ctctctc |
307 |
Q |
| |
|
|| |||| |
|
|
| T |
42816161 |
ctgtctc |
42816167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University