View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_18 (Length: 276)
Name: NF10269_low_18
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 19 - 133
Target Start/End: Complemental strand, 2783254 - 2783140
Alignment:
| Q |
19 |
tacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactctttcaagagttctttgatggacattcctcttgtttcagtcttaagatcattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2783254 |
tacttgtgttaattgctatagtttcaaacagcttcttcgtcgttactctttcaagagttctttgatggacattcctcttgtttcagtcttaagatcattc |
2783155 |
T |
|
| Q |
119 |
atcatcatttgtata |
133 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2783154 |
atcatcatttgtata |
2783140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 57 - 132
Target Start/End: Original strand, 44291797 - 44291872
Alignment:
| Q |
57 |
gtcgttactctttcaagagttctttgatggacattcctcttgtttcagtcttaagatcattcatcatcatttgtat |
132 |
Q |
| |
|
||||||||||||| |||||||| |||| ||| |||||||||||||| || ||||||| ||| |||| || ||||| |
|
|
| T |
44291797 |
gtcgttactcttttaagagttccttgacggatattcctcttgtttccatcataagatccttcgtcattatctgtat |
44291872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University