View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_24 (Length: 242)
Name: NF10269_low_24
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 28 - 221
Target Start/End: Complemental strand, 33731533 - 33731340
Alignment:
| Q |
28 |
agggaggcagtttatggcacatgcatctatatattcataagattcactctgtcagtgtaatctcttaagacagtatcaaattttgttgttttctgattca |
127 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33731533 |
agggtggcagtttatggcacatgcatctatataatcataagattcactctgtcagtgtaatctcttaagacagtatcaaattttgttgttttctgattca |
33731434 |
T |
 |
| Q |
128 |
ttgcaataaacaaaattgaacgcgaatctcgtggaaatatttggtatatgactacatatattaatgaatcaatttgattcttcacgatgtgtca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33731433 |
ttgcaataaacaaaattgaacgcgaatctcgtggaaatatttggtatatgactacatatattaatgaatcaatttgattcttcacgatgtgtca |
33731340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University