View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_25 (Length: 240)
Name: NF10269_low_25
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 45942404 - 45942512
Alignment:
| Q |
18 |
aaagtaattcacaagtcttagacgattttatttatccatttaggtgtctctcagtttagcatcattttttctagcattgtcaatattgtcgttatatact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45942404 |
aaagtaattcacaagtcttagacgattttatttatccatttaggtgtctctcagtttagcatcattttttctagcattgtcaatattgtcgttatatact |
45942503 |
T |
 |
| Q |
118 |
actccttta |
126 |
Q |
| |
|
| ||||||| |
|
|
| T |
45942504 |
attccttta |
45942512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University