View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10269_low_25 (Length: 240)

Name: NF10269_low_25
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10269_low_25
NF10269_low_25
[»] chr7 (1 HSPs)
chr7 (18-126)||(45942404-45942512)


Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 45942404 - 45942512
Alignment:
18 aaagtaattcacaagtcttagacgattttatttatccatttaggtgtctctcagtttagcatcattttttctagcattgtcaatattgtcgttatatact 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45942404 aaagtaattcacaagtcttagacgattttatttatccatttaggtgtctctcagtttagcatcattttttctagcattgtcaatattgtcgttatatact 45942503  T
118 actccttta 126  Q
    | |||||||    
45942504 attccttta 45942512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University