View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_28 (Length: 230)
Name: NF10269_low_28
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 7 - 230
Target Start/End: Complemental strand, 6685027 - 6684805
Alignment:
| Q |
7 |
tgattggcataaattacttttccagcatcacattttccaaattgcgttacaaaatcatgttttcataaaagcattctggaataagtcaatctcgaagtgt |
106 |
Q |
| |
|
||||| |||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6685027 |
tgatttgcataaattatttttccaacatcgcattttccaaattgcgttacaaaatcatgttttcataaacgcattctggaataagtcaatctcgaagtgt |
6684928 |
T |
|
| Q |
107 |
ttcannnnnnnagctttccattcattcaattgcaattgagaaagcatgggcaacagaaggagaattcgagcagatattgatagctaaaataaattctaga |
206 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6684927 |
ttcattttgctagctttccattcattcagttgcaattgagaaagcat-ggcaacagaaggagaattcgagcagatattgatagcgaaaataaattctaga |
6684829 |
T |
|
| Q |
207 |
ttcattcatgtttagaatcgcatt |
230 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
6684828 |
ttcattcatgtttggaatcgcatt |
6684805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University