View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_32 (Length: 211)
Name: NF10269_low_32
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 196
Target Start/End: Original strand, 5788458 - 5788643
Alignment:
| Q |
12 |
caaaggaaggtaagaaacacagtgcaccagcaccttcaccggcattggaaggacctcctgcacctccggctggtgctcctggacctagtctcgatgcttc |
111 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5788458 |
caaagaaaggtaagaaacacagtgcaccagcaccttcaccggcattggaaggacctcctgcacctccggttggtgctcctggacctagtctcgatgcttc |
5788557 |
T |
 |
| Q |
112 |
ttctcccggtccagcatctgctgccgacgaggtacattcatgtctcctctttacg-ttttatttttatttcatgcatgtttgatat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5788558 |
ttctcccggtccagcatctgctgccgacgaggtacattcatgtctcctctttacgtttttatttttatttcatgcatgtttgatat |
5788643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University