View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10269_low_35 (Length: 206)
Name: NF10269_low_35
Description: NF10269
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10269_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 14 - 69
Target Start/End: Complemental strand, 9516095 - 9516040
Alignment:
| Q |
14 |
aagaatgatgggtgtgaggagaataaggattatgaatttgtaagataacatggtag |
69 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9516095 |
aagaatgatgggtgtgaggggaataaggattatgaatttgtaagataacatggtag |
9516040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University