View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10270_low_12 (Length: 249)
Name: NF10270_low_12
Description: NF10270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10270_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 32618132 - 32618309
Alignment:
| Q |
1 |
tttagacactttaaacatcaaatgaacttgtatatttgaaaagttgttcatgattgnnnnnnnn-acagcacttcaagttttctgcaaaatacaattgaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618132 |
tttagacactttaaacatcaaatgaacttgtatatttgaaaagttgttcatgattgtttttttttacagcacttcaagttttctgcaaaatacaattgaa |
32618231 |
T |
|
| Q |
100 |
gaggagaagatagagattagaaagtttgaaaacctacaaaataaattgaagagaagaagatggggattagaaagtttg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32618232 |
gaggagaagatagagattagaaagtttgaaaacctacaaaataaattgaagagaagaagatggggattagaaagtttg |
32618309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 3593699 - 3593649
Alignment:
| Q |
1 |
tttagacactttaaacatcaaatgaacttgtatatttgaaaagttgttcat |
51 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
3593699 |
tttagacactataaacatcaagtgaacttgtagatctgaaaagttgttcat |
3593649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University