View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10270_low_15 (Length: 238)
Name: NF10270_low_15
Description: NF10270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10270_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 15430409 - 15430187
Alignment:
| Q |
16 |
ggaagtccactaagccttgtgggttttctactttatgaattaacgctataaaagtgcaatcataactttcgcaagtttgccatttctatgaaaatcaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
15430409 |
ggaagtccactaagccttgtgggttttctactttatgaattaacgctataaaagtgcaatcataactttctccaatttgccatttctatgaaaatcaaag |
15430310 |
T |
 |
| Q |
116 |
atgaccctcataaactccgacttaaattctccctaaaaatctttgatgaagacaaaattgattccatcaaacccaagacttttaaaattttcacaatccc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
15430309 |
atgaccctcataaactccgacttaaattctccctaaaaatctttgacgaagacaaaattgattccataaggctcaagacttttaaaattttcacaatccc |
15430210 |
T |
 |
| Q |
216 |
acattgcgtgtttaacctcctct |
238 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
15430209 |
acattgtgtgtttaacctcctct |
15430187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University