View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10270_low_6 (Length: 255)
Name: NF10270_low_6
Description: NF10270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10270_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 135 - 237
Target Start/End: Original strand, 42038964 - 42039066
Alignment:
| Q |
135 |
atgaacaagcaggcagcagccctctccctgcgccgacctcacccttctctccatgtgcaccgtgtatgtgttttgcattcattgttgtcttaggttgcat |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038964 |
atgaacaagcaggcagcagccctctccctgcgccgacctcacccttctctccatgtgcaccgtgtatgtgttttgcattcattgttgtcttaggttgcat |
42039063 |
T |
|
| Q |
235 |
aac |
237 |
Q |
| |
|
||| |
|
|
| T |
42039064 |
aac |
42039066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 42038831 - 42038920
Alignment:
| Q |
1 |
taagtgtaaaacaattcttgacaagactataattaccccacggcatttgaattactaatgtcccttccccctaagaatcggagggttaac |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42038831 |
taagtgtaaaacaattcttgacaagactataattaccacacggcatttgaattactaatgtcccttccccctaagaatcggagggttaac |
42038920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University