View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10270_low_7 (Length: 254)
Name: NF10270_low_7
Description: NF10270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10270_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 37 - 238
Target Start/End: Complemental strand, 31079315 - 31079114
Alignment:
| Q |
37 |
ggcggagtaagaagagtaacatcacacttattatttgaaagctataatcaaacattatacatgaggggaaggaaagatgcatcgacacgagtttgctcca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079315 |
ggcggagtaagaagagtaacatcacacttattatttgaaagctataatcaaacattatacatgaggggaaggaaagatgcatcgacacgagtttgctcca |
31079216 |
T |
 |
| Q |
137 |
acatacacttcttctgcaccaagctcctcaattttcaatagcttcaacttgagatccacatatttagtgcatgtttaacagtgaaaactaattaaagcta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079215 |
acatacacttcttctgcaccaagctcctcaattttcaatagcttcaacttgagatccacatatttagtgcatgtttaacagtgaaaactaattaaagcta |
31079116 |
T |
 |
| Q |
237 |
ga |
238 |
Q |
| |
|
|| |
|
|
| T |
31079115 |
ga |
31079114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University