View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10270_low_9 (Length: 250)
Name: NF10270_low_9
Description: NF10270
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10270_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 8405833 - 8406072
Alignment:
| Q |
5 |
tgttggggatcatacgcctaaattagggtttgacctaacaaaagggataagtccaaaccttggaaatgtaacgtttataaaagcataaagggtagagaga |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8405833 |
tgttggggatcatacgcctaaattagggtttgacctaacaaaagggataagtccaaaccttggaaatgtaacgtttataaaagcataaagggtagagaga |
8405932 |
T |
 |
| Q |
105 |
taatggtacacttca-acgattctcaaaagactaatgccacatctctgaaatgtttgctcgtgaggcaatcacgataggcaaaatactagattatctccc |
203 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8405933 |
taacggtacacttcacacgattctcaaaagactaatgccacatctctgaaatgtttgctcgtgaggcaatcacgataggcaaaatactagattatctccc |
8406032 |
T |
 |
| Q |
204 |
aaacaggataaccacggaaccttgttgttaacctatgctt |
243 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
8406033 |
aaacaggataaccagcgaaccttgttgttaacctaggctt |
8406072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University