View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_high_30 (Length: 290)
Name: NF10271_high_30
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 277
Target Start/End: Complemental strand, 3923375 - 3923117
Alignment:
| Q |
19 |
cctctcgaatatagtagcgactttaggccttcatcaagagatcattggccaccaagcattggtgttttggaacttggaatcttaaaagcaactaatttga |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923375 |
cctctcgaatatagtagtgactttaggccttcatcaagagatcattggccaccaagcattggtgttttggaacttggaatcttaaaagcaactaatttga |
3923276 |
T |
|
| Q |
119 |
tgccaatgaagattggggggagaaccgatgcatattgtgtggcgaaatatggaccaaaatgggtaaggacaagaaccagtgttgacagccgtgaaccaag |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3923275 |
tgccaatgaagattggggggagaaccgatgcatattgtgtggcgaaatatggaccaaaatgggtaaggacaagaacaagtgttgacagccgtgaaccaag |
3923176 |
T |
|
| Q |
219 |
atggaatgagcaatatgtttgggaagtttatgagccattcacagtcattactattggag |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3923175 |
atggaatgagcaatatgtttgggaagtttatgagccattcacagtcattactattggag |
3923117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 251
Target Start/End: Complemental strand, 27253757 - 27253646
Alignment:
| Q |
140 |
gaaccgatgcatattgtgtggcgaaatatggaccaaaatgggtaaggacaagaaccagtgttgacagccgtgaaccaagatggaatgagcaatatgtttg |
239 |
Q |
| |
|
||||||| ||||||||||| || || ||||| | |||||||| || ||||| || | |||||| || | | |||||| ||||||||||||||| ||| |
|
|
| T |
27253757 |
gaaccgacgcatattgtgtagctaagtatggttctaaatgggtgagaacaaggactattgttgatagtctttcaccaaggtggaatgagcaatatacttg |
27253658 |
T |
|
| Q |
240 |
ggaagtttatga |
251 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27253657 |
ggaagtttatga |
27253646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University