View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_high_36 (Length: 269)
Name: NF10271_high_36
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 257
Target Start/End: Complemental strand, 50505633 - 50505394
Alignment:
| Q |
18 |
cttatgatatcttatcaaccggaactgacgccggcgccggaagtagaagcagaaagaaggttaaaaagagcactcatggctctaacctgcatctcaagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505633 |
cttatgatatcttatcaaccggaactgacgccggcgccggaagtagaagcagaaagaaggttaaaaagagcactcatggctctaacctgcatctcaagtg |
50505534 |
T |
 |
| Q |
118 |
caggtatataatcaatagcttcttcaagaatcaccggtaatggttcctttttgcaaccaggaaccaaccctccaagaaaccttactttcctttgcatact |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50505533 |
caggtatataatcaatagcttcttcaagaatcaccggtaatggttcctttttgcaaccaggaaccaaccctccaagaaaccttactttcctttgcatact |
50505434 |
T |
 |
| Q |
218 |
tggtaccacctttcccttcaaccggaaaacattgaccctt |
257 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50505433 |
tggtactacctttcccttcaaccggaaaacattgaccctt |
50505394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 92 - 186
Target Start/End: Original strand, 12913636 - 12913730
Alignment:
| Q |
92 |
catggctctaacctgcatctcaagtgcaggtatataatcaatagcttcttcaagaatcaccggtaatggttcctttttgcaaccaggaaccaacc |
186 |
Q |
| |
|
|||||| | ||| ||||||||||| || ||||||||||||||| ||||||||||||| |||||||| ||||| ||| | ||||||||||| |||| |
|
|
| T |
12913636 |
catggcacgaacttgcatctcaagagctggtatataatcaataacttcttcaagaataaccggtaacggttcttttctacaaccaggaactaacc |
12913730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University