View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10271_high_44 (Length: 244)

Name: NF10271_high_44
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10271_high_44
NF10271_high_44
[»] chr4 (1 HSPs)
chr4 (1-236)||(55076630-55076865)
[»] chr6 (1 HSPs)
chr6 (1-112)||(15125312-15125423)
[»] chr1 (1 HSPs)
chr1 (75-157)||(43665606-43665688)


Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 55076630 - 55076865
Alignment:
1 gtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta 100  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076630 gtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta 55076729  T
101 tgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttctta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076730 tgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttctta 55076829  T
201 tcaatattccttctcgctctcgtttcttcctttgct 236  Q
    ||||||||||||||||||||||||||||||||||||    
55076830 tcaatattccttctcgctctcgtttcttcctttgct 55076865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 15125423 - 15125312
Alignment:
1 gtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta 100  Q
    |||||||| |||||||||| ||||  ||||||||||||||||||||||| |||||||  ||||||||||| ||||||||||| || ||| ||||||||||    
15125423 gtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaatgtccttggtta 15125324  T
101 tgccgccggctc 112  Q
    ||| || |||||    
15125323 tgctgctggctc 15125312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 157
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
75 atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc 157  Q
    |||||||| || || ||||| ||||| ||||||||  ||| ||||||||||| |||| ||||||| |||||| |||| |||||    
43665688 atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc 43665606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University