View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_high_44 (Length: 244)
Name: NF10271_high_44
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 55076630 - 55076865
Alignment:
| Q |
1 |
gtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076630 |
gtgccttccttggtgaccttgctgccggtgatcaccgtagaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta |
55076729 |
T |
|
| Q |
101 |
tgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076730 |
tgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagcttgcgatgtcttttgcgctaatctcaaaacatgtttcttctta |
55076829 |
T |
|
| Q |
201 |
tcaatattccttctcgctctcgtttcttcctttgct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076830 |
tcaatattccttctcgctctcgtttcttcctttgct |
55076865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 15125423 - 15125312
Alignment:
| Q |
1 |
gtgccttccttggtgaccttgctgccggtgatcaccgtcgaatgagaatgggcaatgccatgttctctttcttcatggccgtgggaaatatccttggtta |
100 |
Q |
| |
|
|||||||| |||||||||| |||| ||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||| || ||| |||||||||| |
|
|
| T |
15125423 |
gtgccttcattggtgacctcgctggtggtgatcaccgtcgaatgagaattggcaatgggatgttctcttttttcatggccgtcggtaatgtccttggtta |
15125324 |
T |
|
| Q |
101 |
tgccgccggctc |
112 |
Q |
| |
|
||| || ||||| |
|
|
| T |
15125323 |
tgctgctggctc |
15125312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 157
Target Start/End: Complemental strand, 43665688 - 43665606
Alignment:
| Q |
75 |
atggccgtgggaaatatccttggttatgccgccggctctttcagcaaactctatcacatgtttcctttcacccaaactaaagc |
157 |
Q |
| |
|
|||||||| || || ||||| ||||| |||||||| ||| ||||||||||| |||| ||||||| |||||| |||| ||||| |
|
|
| T |
43665688 |
atggccgtcggtaacatcctcggttacgccgccggtgcttacagcaaactctttcacgtgtttccgttcaccaaaacaaaagc |
43665606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University