View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_high_52 (Length: 239)
Name: NF10271_high_52
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 38187415 - 38187192
Alignment:
| Q |
1 |
tatgatcgcgctggtagaattattaagggagaggtaagacatgcattctatatatttattgcctcataatttgaagttgcatatcagtcttgcactaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
38187415 |
tatgatcgcgctggtagaattattaagggagaggtaagacatgcattctatatatttattgcctcataatttcaagttgcatatcagtcttacactaaat |
38187316 |
T |
 |
| Q |
101 |
gccttctttgtgatatcactggttttatacatgatctgttaatttccctagggattcattattggnnnnnnnncaactcttaagcattatgcttttagcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38187315 |
gccttctttgtgatatcactggttttagacatgatctgttaatttccctagggattcattattggtttttgttcaactcttaagcattatgcttttagcc |
38187216 |
T |
 |
| Q |
201 |
tttgctgttctataggatgataat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38187215 |
tttgctgttctataggatgataat |
38187192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 38923488 - 38923578
Alignment:
| Q |
1 |
tatgatcgcgctggtagaattattaagggagaggtaagacatgcattctatatatttattgcctcataatttgaagttgcatatcagtctt |
91 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||| ||||||||||||| |||||| |||| ||||| || |||||||||| |||| |
|
|
| T |
38923488 |
tatgatcgtgctggtagaattgttaagggacaggtaagaaatgcattctatatctttattatctcacaatttcaatttgcatatcaatctt |
38923578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University