View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_high_55 (Length: 237)
Name: NF10271_high_55
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_high_55 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 46210027 - 46209791
Alignment:
| Q |
1 |
gtgtactacattaatttaatgactgagctgacatggctgcagttaatccaatactccaagattgtagcacatcaatatctcgtgatttagtttctttgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46210027 |
gtgtactacattaatttaatgactgagctgacatggctgcagttaaaccaatactccaagattgtagcacatcaatatctcgtgatttagtttctttgta |
46209928 |
T |
 |
| Q |
101 |
gggatatgatgatcatttagctctcaagtggtggcttctagaattcatgttctaatactaaattaaaccccctctgtacaaaagctgttttgctcttaag |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46209927 |
gggatatgataatcatttagctctcaagtggtggcttctagaattcatgttctaatactaaattaaaccccctctgtacaaaagctgttttgctctcaag |
46209828 |
T |
 |
| Q |
201 |
tggtagcgcaaaccaaccaatcacttgcttaccattc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46209827 |
tggtagcgcaaaccaaccaatcacttgcttaccattc |
46209791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University