View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_100 (Length: 242)
Name: NF10271_low_100
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_100 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 53464965 - 53465187
Alignment:
| Q |
1 |
tttttctactatttctgtcttgcaaggaacaatgaacccttgagtttagttgagttgagttgaattaaaactcttttatgtttcacattcacacactatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53464965 |
tttttctactatttctgtcttgcaaggaacaatgaacccttgagtttagttgagttgagttgaattaaaactcttt-atgtttcacattcacacactatt |
53465063 |
T |
|
| Q |
101 |
cccctccatatatagagtacactttgagtttcaacttttaaaccattataccactaaaacttctttcctctctctttctctcttaatcaatagctataat |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
53465064 |
cccctccatatatag--tacactttgagtttcaacttttaaaccattataccactaaaacttctttcatctctctttctctcttaatcaatagctataat |
53465161 |
T |
|
| Q |
201 |
catgaataattttcatcctaatactt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
53465162 |
catgaataattttcatcctaatactt |
53465187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University