View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_101 (Length: 242)
Name: NF10271_low_101
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_101 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 59 - 240
Target Start/End: Complemental strand, 26672018 - 26671844
Alignment:
| Q |
59 |
gcaacacgtagagcacatcgggcaactagaggctaaaggctaaagtccctttcatgctttcatttttcatttgtaaatccaaaatagagaacaggtggtg |
158 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
26672018 |
gcaacacgtagagcatatcgggcaacta-------aaggctaaagtccctttcatgctttcatttttcatttgtaaatccaaaatagagaacacgtggtg |
26671926 |
T |
 |
| Q |
159 |
tattgagctaattattttagctttttggaaagnnnnnnntaagtagaaaaatacatattcaaatttgtcaataacaatatac |
240 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26671925 |
tattgagctaattatttaagctttttggaaagaaaaaaataagtagaaaaatacatattcaaatttgtcaataacaatatac |
26671844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University