View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_104 (Length: 241)
Name: NF10271_low_104
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_104 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 38024744 - 38024966
Alignment:
| Q |
19 |
acacattcacaatagataaaataaaagtctacatatgcgaatgaattgaatctcaaaacaactggaccaatgtgcaaagtagtctcaatcacaaaaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38024744 |
acacattcacaatagataaaataaaagtctgcatatgcgaatgaattgaatctcaaaacaactggaccaatgtgcaaagtagtctcaatcacaaaaatct |
38024843 |
T |
 |
| Q |
119 |
aaatactactgattgccagaattgctgttgttattcaactcaagatcattcttgcagttctctctcaaatctttcagtttttaagagcttgatttctaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38024844 |
aaatactactgattgccagaattgctgttgttattcaactcaagatcattcttgcagttctctctcaaatctttcagtttttaagagcttgatttctaaa |
38024943 |
T |
 |
| Q |
219 |
aacaacaaaccagggtgcagatc |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38024944 |
aacaacaaaccagggtgcagatc |
38024966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 38028239 - 38028335
Alignment:
| Q |
123 |
actactgattgccagaattgctgttgttattcaactcaagatcattcttgcagttctctctcaaatctttcagtttttaagagcttgatttctaaaa |
219 |
Q |
| |
|
|||| ||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||| |||||||||| ||| | ||||||||| |||||| |
|
|
| T |
38028239 |
actaatgattgctagagctgctgttgttggtcaactcaagatcattcttgcagttctctctcacatctttcagtgtttcaaagcttgattcctaaaa |
38028335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University