View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_105 (Length: 241)
Name: NF10271_low_105
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 10465391 - 10465161
Alignment:
| Q |
1 |
aacatctgggttacttcagggtccatcgacccggctgagaagttaatgccgtgcatgattcgtcataccgataagagttcgtccact------ttccacc |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
10465391 |
aacatctgggttacttcagggtccatcgacccgactgagaagttaatgccgtgcatgattcgtcatacctataagagttcgtccactgccactttccacc |
10465292 |
T |
|
| Q |
95 |
gcctctcacctgagcggctacgcaatgtctggatctcaggactccttgacccttccaagcttcttttaaccgagagaagactgttatacactggtgagat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10465291 |
gcctctcacctgagcggctacgcaatgtctggatctcaggactccttgacccttccaagcttcttttaaccgagagaagactgttatacactggtgagat |
10465192 |
T |
|
| Q |
195 |
cgataagatggaggatgctaggtgtgaaatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10465191 |
cgataagatggaggatgctaggtgtgaaatt |
10465161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University