View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_112 (Length: 239)
Name: NF10271_low_112
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_112 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 3077061 - 3077294
Alignment:
| Q |
1 |
ttttgaaaattatttctctttgtgtcctctatatgctgccatcttatttggcttggtgttgtattggtttttaaagttttctctttgtgtgtgtatgtat |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3077061 |
ttttgaaaattatttcactttgtgtcctctatatgctgccatcttatttggcttggtgttgtattggtttttaaagttttctctttgtgtgtgtatgtat |
3077160 |
T |
|
| Q |
101 |
tcatttctattcatatgtattcaagtactgtgtatatctgcattcatattcaatttagggtttcaagatttaaaaatttaagctattgttttgttctact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3077161 |
tcatttctattcatatgtattcaagtactgtgtatatctgcattcatattcaatttagggtttcaagatttaaaaatttaagctattgttttgttctact |
3077260 |
T |
|
| Q |
201 |
gaaatataggagcttattgttattgatgatgtcc |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
3077261 |
gaaatataggagcttattgttattgatgaagtcc |
3077294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University