View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_113 (Length: 239)
Name: NF10271_low_113
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_113 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 34792572 - 34792357
Alignment:
| Q |
1 |
aaggagaattgtaggg-aataaatcaaaaatagaggacggtgatgtcaatcaaatggagtacatgaaatgtgtcatcaaagaaactttgaggatgcatcc |
99 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34792572 |
aaggagaattgtaggggaataaataaaaaatagaggacagtgatgtcaatcaaatggagtacatgaaatgtgtcatcagagaaactttgaggatgcatcc |
34792473 |
T |
 |
| Q |
100 |
tgctggtcctcttttggctcctagagaaacaacatctagtgttaaactcggagggtatggtattcctgataaaacaacggtatatatcaacgcatgggta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34792472 |
tgctggtcctcttttggctcctagagaaacaacatctagtgttaaactcggagggtatggtattcctgataaaacaacggtatatatcaacgcatgggta |
34792373 |
T |
 |
| Q |
200 |
atccagagggaccctg |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34792372 |
atccagagggaccctg |
34792357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 34417581 - 34417795
Alignment:
| Q |
1 |
aaggagaattgtagggaataaatcaaaaatagaggacggtgatgtcaatcaaatggagtacatgaaatgtgtcatcaaagaaactttgaggatgcatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||| |
|
|
| T |
34417581 |
aaggagaattgtagggaataaatcaaaaatagaggatagtgatgtcaatcaaatggagtacatgatatgtgtaattaaagaaactttgaggatgcatcca |
34417680 |
T |
 |
| Q |
101 |
gctggtcctcttttggctcctagagaaacaacatctagtgttaaactcggagggtatggtattcctgataaaacaacggtatatatcaacgcatgggtaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||||||| ||||| |||||| || |
|
|
| T |
34417681 |
gctgctcctcttttggctcctagaaaaacaacatctagtgttaaactcggtgggtatgatattcctgataaaacaatggtatatgtcaacacatgggcaa |
34417780 |
T |
 |
| Q |
201 |
tccagagggaccctg |
215 |
Q |
| |
|
|||| |||||||||| |
|
|
| T |
34417781 |
tccatagggaccctg |
34417795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University