View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_126 (Length: 227)
Name: NF10271_low_126
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_126 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 41347464 - 41347246
Alignment:
| Q |
1 |
ggagtgattaattttaattagtggtgagacaatttaaaattaattataagagcgttaaaagtatcagatttataagagtgttaatggaaattagaatatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347464 |
ggagtgattaattttaattagtggtgagacaatttaaaattaattatatgagcgttaaaagtatcagatttataagagtgttaatggaaattagaatatt |
41347365 |
T |
|
| Q |
101 |
gtattgttagcgacgtgtgccttgaactgagattaaaccaagtcagatttattttcatattttgtccttccttcctattgaatctcacgcccgagccctc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41347364 |
gtattgttagcgacgtgtgcctttaactgagattaaaccgagtcagatttattttcatattttgtccttccttcctattgaagctcacgcccgagccctc |
41347265 |
T |
|
| Q |
201 |
actctctcgatttcatctc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41347264 |
actctctcgatttcatctc |
41347246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University