View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_127 (Length: 227)
Name: NF10271_low_127
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_127 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 9047260 - 9047470
Alignment:
| Q |
18 |
ccttgtaaatcataaacttggtctctttttaaagcacgaattgtctttttatatcaaccatttcccnnnnnnnnn---cttctcatcagcatgttacata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
9047260 |
ccttgtaaatcataaacttggtctctttttaaagtacgaattgtctttttatatcaaccatttccttttttttttttccttctcatcagcatgttgcata |
9047359 |
T |
 |
| Q |
115 |
tatactttatgtcatttacattagtaaacaannnnnnnnaatcttgaaattatcggaagataccatattacatttacattagaaacttctgtgctaccat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
9047360 |
tatactttatgtcatttacattagtaaacaattttttttaatcttgaaattatcggaagataccatattacatttacattagaaacttttatgctaccat |
9047459 |
T |
 |
| Q |
215 |
cattgctagaa |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
9047460 |
cattgctagaa |
9047470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University