View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_132 (Length: 224)
Name: NF10271_low_132
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_132 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 25 - 207
Target Start/End: Original strand, 3566944 - 3567127
Alignment:
| Q |
25 |
tcccttacattatcaaccctcacaaaacatcattct-gacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3566944 |
tcccttacattatcaaccctcacaaaacatcattctagacaactaatctcttttgctagatgttcaagttaataacatactttttgcttctcagttcaaa |
3567043 |
T |
 |
| Q |
124 |
ttcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggagttttaatgtgattggttgccctatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3567044 |
ttcatgagaatgtgggtttctcatcctgattgttccacaattgttagagatagctggatttttaatgtgattggttgccctatg |
3567127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University