View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_135 (Length: 220)
Name: NF10271_low_135
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_135 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 47569381 - 47569600
Alignment:
| Q |
1 |
ctctccattcaccctaaccatggcagtgccatcagaaacttttatatcagaaatttctttgggaagagaaacttcaagcaatttggaccgaacaagcatg |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47569381 |
ctctccattcaccctaaccattgcagtgccatcggaaacttttatatcagaaatttctttgggaagagaaacttcaagcaatttggaccgaacaagcatg |
47569480 |
T |
 |
| Q |
101 |
tccagcttcttcaaagcaggcttttgcttatcttcattcaaagcatactgagaaccaacatcttcaatacactttggcaaacgctcgtaactccccgtga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47569481 |
tccagcttcttcaaagcaggcttttgcttatcttcggtcaaagcatactgagaaccaacatcttcaatacactttggcaaacgctcgtaactccccgtga |
47569580 |
T |
 |
| Q |
201 |
gaagaatttcaatggcggat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
47569581 |
gaagaatttcaatggcggat |
47569600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 38977067 - 38977286
Alignment:
| Q |
1 |
ctctccattcaccctaaccatggcagtgccatcagaaacttttatatcagaaatttctttgggaagagaaacttcaagcaatttggaccgaacaagcatg |
100 |
Q |
| |
|
|||||||| |||| ||||||| ||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38977067 |
ctctccatccaccttaaccattgcagtaccatcagaaacccttatatcagaaagttctttgggaagagaaacttcaagcaatttggaccgaacgagcatg |
38977166 |
T |
 |
| Q |
101 |
tccagcttcttcaaagcaggcttttgcttatcttcattcaaagcatactgagaaccaacatcttcaatacactttggcaaacgctcgtaactccccgtga |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| || |||||||||||||||| |||||||||||| |||| |
|
|
| T |
38977167 |
tccaacttcttcaaagcaggcttttgcttatcttgagtcaaagcatactgagaaccaacatcatctatacactttggcaaacactcgtaactcccggtga |
38977266 |
T |
 |
| Q |
201 |
gaagaatttcaatggcggat |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38977267 |
gaagaatttcaatggcggat |
38977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University