View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_139 (Length: 210)
Name: NF10271_low_139
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_139 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 11644550 - 11644375
Alignment:
| Q |
14 |
caaaggcagttgaacagtgaacaagctttatataagatcaatatcctatgatacagatttccaagatcaaaatttattatatatttaannnnnnnnnatt |
113 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
11644550 |
caaagccagttgaacaatgaacaagctttatatgagatcaatatcctatgattcagatttc-aagatcaaaatttattatatatttaattttttct-att |
11644453 |
T |
 |
| Q |
114 |
aaaatcagagccgtttgattttgatcagacaactgtgaacaattgacttcagctactcgactcgactacacttacatt |
191 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11644452 |
aaaattagagccgtttgattttgatcagacaattgtgaacaattgacttcagctactcgactcgactacacttacatt |
11644375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University