View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_140 (Length: 210)
Name: NF10271_low_140
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_140 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 45122966 - 45122784
Alignment:
| Q |
17 |
atgatttcaggttttgtgtatgttgggagacatcactgctggacctgctattatgttcacacaatggcttcaatcagttcgtaaacgaacttccaatcat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45122966 |
atgatttcaggttttgtgtatgttgggagacatcactgctggacctgctattatgttcacacaatggcttcaatcagttcgtaaacgaacttccagtcat |
45122867 |
T |
|
| Q |
117 |
cgttcctctggatttcctcgctcttcttccactctccccttttggtttgtttcatactacttttttcttgttatcattttcat |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45122866 |
cgctcctctggatttcctcgctcttcttccactctccccttttggtttgtttcatactactttcttcttgttatcattttcat |
45122784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 71 - 136
Target Start/End: Complemental strand, 40259109 - 40259044
Alignment:
| Q |
71 |
gttcacacaatggcttcaatcagttcgtaaacgaacttccaatcatcgttcctctggatttcctcg |
136 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||| || |||| |||||||| || ||||| |
|
|
| T |
40259109 |
gttcacacaatggcttcaattggttcgtaaacgcacttcaaagtatcgatcctctggcttccctcg |
40259044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University