View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_17 (Length: 440)
Name: NF10271_low_17
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 8e-31; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 345 - 421
Target Start/End: Original strand, 1956962 - 1957038
Alignment:
| Q |
345 |
catattatggatttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttca |
421 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1956962 |
catattatggatttgattaaattttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaacttca |
1957038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 1956794 - 1956853
Alignment:
| Q |
1 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaaa |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1956794 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatctaggtaaaaa |
1956853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 355 - 418
Target Start/End: Original strand, 1942053 - 1942116
Alignment:
| Q |
355 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagcaact |
418 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
1942053 |
atttgattgaactttaatgcactttgcaggaggctagagggtgatagatttttcacaagcaact |
1942116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 355 - 414
Target Start/End: Original strand, 1928076 - 1928135
Alignment:
| Q |
355 |
atttgattgaactttcatgcactttgaaggaggctagaggctgataggtttttcacaagc |
414 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| | |||||| |||||||||||| |
|
|
| T |
1928076 |
atttgattgaactttaatgcactttgtaggaggctagaaggtgatagatttttcacaagc |
1928135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 1941703 - 1941761
Alignment:
| Q |
1 |
ggttttgcaattagtgagacatcttttgtgatattccttatcatggcatcaaggtaaaa |
59 |
Q |
| |
|
||||||||||||||||||||| ||||| | || |||||| |||||||||| |||||||| |
|
|
| T |
1941703 |
ggttttgcaattagtgagacagcttttttaatcttccttctcatggcatctaggtaaaa |
1941761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 263 - 306
Target Start/End: Original strand, 36774869 - 36774912
Alignment:
| Q |
263 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774869 |
taatttttaaatcccataagaacaagtgtgatatgcctcagtat |
36774912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University