View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_21 (Length: 424)
Name: NF10271_low_21
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 38520547 - 38520943
Alignment:
| Q |
1 |
actcgtatgacaatttctttcaccatatattctagttaaatagatttttgactcacctaatcccccctctttctccaacactttttcatagatgaatagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520547 |
actcgtatgacaatttctttcaccatataatctagttaaatagatttttgactcacctaatcccccctctttctccaacactttttcatagatgaatagg |
38520646 |
T |
|
| Q |
101 |
catattgtccggccaaatcgtcctacattatccatcttcttcaacgcttcgtttacatcttgctcttgaatccaacgatagtagttataatttgggtcac |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
38520647 |
catattgtccggccaaatcgctctacattatccatcttcttcaacgcttcgtttacatcttgctcttgaatccaacgatagtagatataatttcggtcac |
38520746 |
T |
|
| Q |
201 |
cctttgttatatctagcctactagagtatgtagaatttcacattctttcattaaataggttgttaaaaccatgtttctattcatcttttatacccttttc |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520747 |
cctttattatatctagcctactagagtatgtagaatttcacattctttcattaaataggttgttaaaaccatgtttctattcatcttttatacccttttc |
38520846 |
T |
|
| Q |
301 |
ctgaaccaaaactttttcttctttatcctttatacattttcacttgatccaagtcttttgtcttactttttggccctttagcaaacgtatgtataga |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38520847 |
ctgaaccaaaactttttcttctttatcctttatacattttcacttgatccaagtcttttgtcttactttttggccctttagcaaacgtatgtataga |
38520943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 189
Target Start/End: Complemental strand, 56224579 - 56224530
Alignment:
| Q |
140 |
ttcaacgcttcgtttacatcttgctcttgaatccaacgatagtagttata |
189 |
Q |
| |
|
||||||||||| ||||| || || ||||||||||||| |||||||||||| |
|
|
| T |
56224579 |
ttcaacgcttcttttacctcatgttcttgaatccaacaatagtagttata |
56224530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University