View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_62 (Length: 304)
Name: NF10271_low_62
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_62 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 21 - 296
Target Start/End: Complemental strand, 9397264 - 9396989
Alignment:
| Q |
21 |
atagttaacctgtaaataacttaattttcagctcattaattcaatgtatgaattcttccttctcagttctcgctagttaaaacggatctttaaggataac |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9397264 |
atagttaacctgtaactaacttaattttcagctcattgattcaacgtatgagttcttccttctcagttctcgctagttaaaatggatctttaaggataac |
9397165 |
T |
|
| Q |
121 |
catgtacacttcttcttaaatctcaccatgcaaaaattattattaacatgaacttgtggagatgctagttgttgatagaatctaaaatcatgatcattct |
220 |
Q |
| |
|
||| || |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9397164 |
catttatacttcttcttgaagctcaccatgcaaaaattattattaacatgaacttgtggagatgctagttgttgatagaatctaaaatcatgatcattct |
9397065 |
T |
|
| Q |
221 |
gacattagttaacttagcgattgaggaaaatgtgtcataatagtataacctttctatttgattgtaaccctttgct |
296 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9397064 |
gacattagttaacttcgcgattgaggaaaatgtgtcataatagtataacctttctatttgattgtaaccctttgct |
9396989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University