View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_79 (Length: 272)
Name: NF10271_low_79
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 82 - 244
Target Start/End: Complemental strand, 41347817 - 41347655
Alignment:
| Q |
82 |
gtgagtcgatcaaccattgaattagggaaaataagggatgattggacaaaaaa-gataagagaagatccaattccgtcataaccatgcagtttcattgaa |
180 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||| || |||||||| ||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347817 |
gtgagtcgatcaaccattgaattagg-aaaaggagggatgactgaacaaaaaaagataaataaatatccaattccgtcataaccatgcagtttcattgaa |
41347719 |
T |
|
| Q |
181 |
tagaggcaattagttggtgggatggtgtacggaattttttacatgaccaaaacaactttatggg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347718 |
tagaggcaattagttggtgggatggtgtacggaattttttacatgaccaaaacaactttatggg |
41347655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University