View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10271_low_96 (Length: 247)
Name: NF10271_low_96
Description: NF10271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10271_low_96 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 46009829 - 46010036
Alignment:
| Q |
1 |
gcttagtttggtttggtgtcaaagacattggtctttgtnnnnnnntcgttagttttccctgcagtgatttatttatttttcacttttataagactaaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009829 |
gcttagtttggtttggtgtcaaagacattggtctttgtaaaaaaatcgttagttttccctgcagtgatttatttatttttcacttttataagactaaaac |
46009928 |
T |
 |
| Q |
101 |
ttttactgtgcgttagattaattaagtcaaacaaacattaaataattcatatgcttaaaaatgaatattaattttgttgcgagttaaataaatattttaa |
200 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46009929 |
ttttattgtgcgttaga---------------------taaataattcatatgcttaaaaatgaatattaattttgttgcgagttaaataaatattttaa |
46010007 |
T |
 |
| Q |
201 |
aacaaatgtcgttttccatttttaatgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46010008 |
aacaaatgtcgttttccatttttaatgtg |
46010036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University