View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10272_high_4 (Length: 250)
Name: NF10272_high_4
Description: NF10272
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10272_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 6082205 - 6082439
Alignment:
| Q |
1 |
tgtagtcatgatcaaaccatttggaattttagactcnnnnnnnnnagcagtatataattttttccttgaccaaaatatgcatgcagaatcagcataattt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082205 |
tgtagccatgatcaaaccatttggaattttagact-tctttttttagcagtatataattttttccttgaccaaaatatgcatgcagaatcagcataattt |
6082303 |
T |
|
| Q |
101 |
gaaggctaattctcctaatggatcaaaagcagtgggagtgggggaaaaagacaagggagaaaacaattttagaaacagacaaagcaaatcttacttcata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6082304 |
gaaggctaattctcctaatggatcaaaagcagtgggagtgggggaaaaagacaagggagaaaacaattttagaaacagacaaagcaaatcttacttcata |
6082403 |
T |
|
| Q |
201 |
tgaaaatgaagaggtaggtaattttaacctttttct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6082404 |
tgaaaatgaagaggtaggtaattttaacccttttct |
6082439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University