View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_high_34 (Length: 318)
Name: NF10273_high_34
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_high_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 17 - 318
Target Start/End: Complemental strand, 44609724 - 44609423
Alignment:
| Q |
17 |
acaatcttcaaaaccttccatggggaaaaagtcgccgttctccgatattgaagcggctcgttatcccccgccaccaccgcctactttctacatgccaccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44609724 |
acaatcttcaaaaccttccatggggaaaaagtcgccgttctccgatattgaagcggctcgttatcccccgccaccaccgcctactttctacatgccaccg |
44609625 |
T |
|
| Q |
117 |
ccaacacaatggttctcatggttggtgccactcnnnnnnnnagccaatattgcaatgttcgtgtatagcatgtatatcaatgattgccctggctatttga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44609624 |
ccaacacaatggttctcatggttggtgccactcttttttttagccaatattgcaatgttcgtgtatagcatgtatatcaatgattgccctggctatttga |
44609525 |
T |
|
| Q |
217 |
atgaagatgattgcctttggtatcaatatttgggaaaattttcttttcaacctttcaatgaaaaccctctccttggcccttctgtccgcacgtgagaatc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44609524 |
atgaagatgattgcctttggtatcaatatttgggaaaattttcttttcaacctttcaatgaaaaccctctccttggcccttctgtccgcacgtgagaatc |
44609425 |
T |
|
| Q |
317 |
tt |
318 |
Q |
| |
|
|| |
|
|
| T |
44609424 |
tt |
44609423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University