View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_high_53 (Length: 240)
Name: NF10273_high_53
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_high_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 87 - 223
Target Start/End: Complemental strand, 12559984 - 12559848
Alignment:
| Q |
87 |
actccataatttaactattctaattgtaacaaaataatataaactctgatgtgtatgtttttatgcatgtatcaattgcttaccggtttccccaacgact |
186 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559984 |
actccataatttaactattctaattataacaaaataatataaactctgatgtgtatgtttttatgcatgtatcaattgcttaccggtttccccaacgact |
12559885 |
T |
 |
| Q |
187 |
atgaagttcaagaataagaagttgttcttcaagtgtg |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559884 |
atgaagttcaagaataagaagttgttcttcaagtgtg |
12559848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 12560092 - 12560041
Alignment:
| Q |
1 |
ctaatttctaatttcacatctctaatatttaacgacgaatttggaaagatga |
52 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12560092 |
ctaatttctaatttcacgtctctaatatttaacgacgaatttggaaagatga |
12560041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 223
Target Start/End: Original strand, 50777842 - 50777900
Alignment:
| Q |
165 |
cttaccggtttccccaacgactatgaagttcaagaataagaagttgttcttcaagtgtg |
223 |
Q |
| |
|
|||||||||| ||||||||| |||| || || ||||| | ||||||||||||||||||| |
|
|
| T |
50777842 |
cttaccggttaccccaacgagtatggagctcgagaatcaaaagttgttcttcaagtgtg |
50777900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University