View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_high_59 (Length: 239)
Name: NF10273_high_59
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_high_59 |
 |  |
|
| [»] scaffold0094 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 17154455 - 17154675
Alignment:
| Q |
1 |
gacttagacataatatatgaatagttttacctcatggaggtattggtgtcttacacacaccatcaatgcaaaacatatgtagaaaacttgcttcgggata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17154455 |
gacttagacataatatatgaatagttttacctcatagaggtataggtgtcttacacacaccatcaatgcaaaacatatgtagaaaacttgcttcgggata |
17154554 |
T |
 |
| Q |
101 |
tattttataacaatcggcgtcagtgacacactcctctataatggaaaagaagaaaaaagaagtattagcaaaaaggggtgagagattgtgtatagtataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17154555 |
tattttataacaatcggcgtcagtgacacactcctctataatgtaaaagaagaaaaaagaagtattagcaaaaaggggtgagagattgtgtatagtataa |
17154654 |
T |
 |
| Q |
201 |
acacaaaattaagaatgagct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17154655 |
acacaaaattaagaatgagct |
17154675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 133
Target Start/End: Complemental strand, 16297 - 16244
Alignment:
| Q |
80 |
tagaaaacttgcttcgggatatattttataacaatcggcgtcagtgacacactc |
133 |
Q |
| |
|
|||||||||| || ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
16297 |
tagaaaactttgtttgggatattttttataacaatcagcgtcagtgacacactc |
16244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University