View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_high_69 (Length: 204)
Name: NF10273_high_69
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_high_69 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 51002087 - 51002259
Alignment:
| Q |
17 |
ggatattgatcagattaatcagatgacagataaacaattaaataaataaatnnnnnnngacttcttattaagagagaggatccacaagaaaatacataca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51002087 |
ggatattgatcagattaatcagatgacagataaacaattaaataaataaat-aaaaaagacttcttattaagagagaggatccacaagaaaatacataca |
51002185 |
T |
 |
| Q |
117 |
attgtctgg-ag-nnnnnnnnnnnnngttatctatttgtttattagtcatccgactaatctaatagtcgaaatt |
188 |
Q |
| |
|
||||| ||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51002186 |
attgtttggtagtttttcttctttttgttatctatttgtttattagtcatccgactaatctaatagtcgaaatt |
51002259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University