View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_29 (Length: 360)
Name: NF10273_low_29
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 115 - 351
Target Start/End: Complemental strand, 4007003 - 4006765
Alignment:
| Q |
115 |
gttgaagtcaaaggggttaggttcagctcttgctttcttctgaccttcagctgttccggtcctgctctgatgttctagttctgctgcagtgttgtggcat |
214 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4007003 |
gttgaagtcaaaagggttaggttcagctgttgctttcttctgaccttcagctgttccagtcctgctctgatgttctagttctgctgcagtgttgtggcat |
4006904 |
T |
|
| Q |
215 |
tttgggatccgtttgacgttgtatcttgcttgctggactgctagtgttgcatcaatttcgtat--ttttatcatttgtagttgtcttggctgcttggcgt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006903 |
tttgggatccgtttgacgttgtatcttgcttgctggactgctagtgttgcatcaatttcgtatttttttatcatttgtagttgtcttggctgcttggcgt |
4006804 |
T |
|
| Q |
313 |
tcaagccctttggggcgttggtattattttgttgatgtc |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4006803 |
tcaagccctttggggcgttggtattattttgttgatgtc |
4006765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University