View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_44 (Length: 297)
Name: NF10273_low_44
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_44 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 36503060 - 36503340
Alignment:
| Q |
1 |
aatcaaaattttgatgtggatgaacattgatgatacctgccaggtatcttgagaccaacggttgcgaccagtatcaagaaagtcatcattgacaatctgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36503060 |
aatcaaaattttgatgtggatgaacattgatgatacctgccaggtatcttgagaccaacggttgcgaccagtatcaagaaagtcatcatcgacaatctgc |
36503159 |
T |
|
| Q |
101 |
caagcttcctgaacaagtccttcattggtaacaacttcaggagcagttggaaccgtgatatctcgtagctcaacatcacggcatgtttcggaggaagtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36503160 |
caagcttcctgaacaagtccttcattggtaacaacttcaggagcagttggaaccgtgatatttcgtagctcaacatcacggcatgtttcggaggaagtag |
36503259 |
T |
|
| Q |
201 |
agagagggattggaaggggattttgttgcagtacagatgtagaagcagttaaaggggatacgaataaatcaaaagacagag |
281 |
Q |
| |
|
|||||||||||||||||||| | |||| || ||||| | ||||| || |||||||||| ||| ||| ||||||| |||| |
|
|
| T |
36503260 |
agagagggattggaaggggagtgggttgaagaacagaggcagaagaagggaaaggggataagaagaaaccaaaagagagag |
36503340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University