View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_50 (Length: 269)
Name: NF10273_low_50
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 25012633 - 25012370
Alignment:
| Q |
1 |
tattttattaattaacttattgatgaattgataacgaatctgagtttaattttagtaacttcgaggtttgtttgtgactctgtatgtagtagataaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25012633 |
tattttattaattaacttattgatgaattgatgatgaatctgactttaattttagtaacttcgaggtttgtttgtgactctgtatgtagcagataaatat |
25012534 |
T |
|
| Q |
101 |
agtatcacttgatttatannnnnnnatatatgagctggataaatatccccaaagtttagaaatttgtcattaattttgtgtga-ttttttattattggat |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
25012533 |
agtatcacttgatttatatttttttatatatgagctggataaatatccccaaagtttagaaa--tgtcattaattttatgtgatttttttattattggat |
25012436 |
T |
|
| Q |
200 |
taaaggtcgatctcccgaactcaatagttgtattgatctctctcatttggatgatctctgcttctc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
25012435 |
taaaggtcgatctcccgaactcaatagttgtattgatctctctcatttggatgatatctgattctc |
25012370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 135 - 226
Target Start/End: Complemental strand, 7934722 - 7934633
Alignment:
| Q |
135 |
ctggataaatatccccaaagtttagaaatttgtcattaattttgtgtgat-tttttattattggattaaaggtcgatctcccgaactcaatag |
226 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||||||||| || |||| ||||| ||| ||||| |||||| |||||||||||| |
|
|
| T |
7934722 |
ctggataaatatcccc-aagtttagaaa--tgtcattaattttgtgtaatactttttttatttgatggaaggttgatctctcgaactcaatag |
7934633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University