View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_55 (Length: 253)
Name: NF10273_low_55
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 39293919 - 39293727
Alignment:
| Q |
1 |
aagatgcaaaatttgcattacacttgagaacaaaagtcagccactaatgtatttcaaatggaacatgaagtccttaagtgcatgtaaatacacacaccta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39293919 |
aagatgcaaaatttgcattacacttgagaacaaaagtcagccactaatgtatttcaaatggaacatgaagtccttaagtgcatgtaaa-acacacaccta |
39293821 |
T |
|
| Q |
101 |
caacaaaggaatggcaactgaatttttgagaactaaaaacatacaatatcaaatactcaaagctcnnnnnnnngttctttacattgaatactaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39293820 |
caacaaaggaatggcaactgaatttttgagaagcaaaaacatacaatatcaaatactcaaagctcttttttttgttctttacattgaatactaa |
39293727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University