View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_62 (Length: 250)
Name: NF10273_low_62
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 240
Target Start/End: Original strand, 52807994 - 52808221
Alignment:
| Q |
13 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtttatggatgaaacctggcaattatggtat |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52807994 |
ataataataatgtgagaaggatgtttgattggtgttagagcataagacaaacaaatacttgcatgattggtctatggatgaaacctggcaattatggtat |
52808093 |
T |
 |
| Q |
113 |
tttgctgtggtgcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagtt |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52808094 |
tttgttgtggtgcgaattggtaattaatcaccttattaactatgtttggctgtactaataaacaactctatcggttagttaagaaactaaactaccagtt |
52808193 |
T |
 |
| Q |
213 |
acaaacaaagtttaagttacagcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52808194 |
acaaacaaagtttaagttacagcctatg |
52808221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University