View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_64 (Length: 244)
Name: NF10273_low_64
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_64 |
 |  |
|
| [»] scaffold1315 (2 HSPs) |
 |  |  |
|
| [»] scaffold1293 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1315 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: scaffold1315
Description:
Target: scaffold1315; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 1217 - 1144
Alignment:
| Q |
1 |
taagaggaacaacatggtaaaaaatgtgagttggtggctatttcatagaggggtgtctttgtttctttctttag |
74 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
1217 |
taagaggaacaacatgataaaaaatgtgagttggtggctatttcgtagaagggtgtctttgtttctttctttag |
1144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1315; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 155 - 222
Target Start/End: Complemental strand, 1063 - 996
Alignment:
| Q |
155 |
ctaaggagagtgtgttttataattgacaatataattaatagaatgagttgctgataatttatgatttt |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1063 |
ctaaggagagtgtgttttatcattgacaatataattaataaaatgagttgctgataatttatgatttt |
996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1293 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: scaffold1293
Description:
Target: scaffold1293; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 854 - 927
Alignment:
| Q |
1 |
taagaggaacaacatggtaaaaaatgtgagttggtggctatttcatagaggggtgtctttgtttctttctttag |
74 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
854 |
taagaggaacaacatgataaaaaatgtgagttggtggctatttcgtagaagggtgtctttgtttctttctttag |
927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1293; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 1008 - 1075
Alignment:
| Q |
155 |
ctaaggagagtgtgttttataattgacaatataattaatagaatgagttgctgataatttatgatttt |
222 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1008 |
ctaagaagagtgtgttttatcattgacaatataattaataaaatgagttgctgataatttatgatttt |
1075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 3e-26; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 42756955 - 42757032
Alignment:
| Q |
1 |
taagaggaacaacatggtaaaaaatgtgagttggtggctatttcatagag----gggtgtctttgtttctttctttag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42756955 |
taagaggaacaacatggtaaaaaatgtgagttggtggctatttcatagagaggtgggtgtctttgtttctttctttag |
42757032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 155 - 222
Target Start/End: Original strand, 42757113 - 42757180
Alignment:
| Q |
155 |
ctaaggagagtgtgttttataattgacaatataattaatagaatgagttgctgataatttatgatttt |
222 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42757113 |
ctaagaagagtgtgttttatcattgacaatataattaatagaatgagttgctgataatttatgatttt |
42757180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 72
Target Start/End: Complemental strand, 39977979 - 39977911
Alignment:
| Q |
3 |
agaggaacaacatggtaaaaaatgtgagttggtggctatttcatagaggggtgtctttgtttctttcttt |
72 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||| ||||| |||||| ||| ||| ||||||||||| |
|
|
| T |
39977979 |
agaggcacaacatggtaaaaaaggtgggttggtggcagtttcaaagagggatgt-tttttttctttcttt |
39977911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 6466863 - 6466792
Alignment:
| Q |
1 |
taagaggaacaacatggtaaaaaatgtgagttggtggctatttcatagaggggtgtctttgtttctttcttta |
73 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
6466863 |
taagaggaacaaaatggtaaaaa-tgtgagttggtgactattacatagaggggtgtctttgttcctttcttta |
6466792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 156 - 218
Target Start/End: Complemental strand, 6466708 - 6466646
Alignment:
| Q |
156 |
taaggagagtgtgttttataattgacaatataattaatagaatgagttgctgataatttatga |
218 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6466708 |
taaggagggtgtgttttatatgtgacaatataattaatagaatgagttgcagataatttatga |
6466646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 10 - 72
Target Start/End: Original strand, 22635700 - 22635762
Alignment:
| Q |
10 |
caacatggtaaaaaatgtgagttggtggctatttcatagaggggtgtctttgtttctttcttt |
72 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| ||| | ||||||||||||| |||||||| |
|
|
| T |
22635700 |
caacatggtaaaaaatgtgagtttgtggcggttttatacaagggtgtctttgttcctttcttt |
22635762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University