View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_65 (Length: 243)
Name: NF10273_low_65
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_65 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 32534036 - 32533811
Alignment:
| Q |
1 |
ttacatattgcgacttgtcttgcagggattgaaagggctatatgcaggctttcctgctgggcttcttggcgcaactatttcatggagtttattagtcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32534036 |
ttacatattgcgacttgtcttgcagggattgaaagggctatatgcaggctttcctgctgggcttcttggcgcaactatttcatggagtttattagtcttt |
32533937 |
T |
 |
| Q |
101 |
tagtaagcagttaaaatttaaacctttcatttttacatctgatactcacttagagagaatgatattatattaggatggcagactctttatctttgcattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32533936 |
tagtaagcagttaaaatttaaacctttcatttttacatctgatactcacttagagagaatgatattatattaggatggcagactctttatctttgcattc |
32533837 |
T |
 |
| Q |
201 |
tgatgtttgtgcatgtagtatagtat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32533836 |
tgatgtttgtgcatgtagtatagtat |
32533811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 103 - 199
Target Start/End: Complemental strand, 32522118 - 32522021
Alignment:
| Q |
103 |
gtaagcagttaaaatttaaacctttcattttt-acatctgatactcacttagagagaatgatattatattaggatggcagactctttatctttgcatt |
199 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||| |||| |||| ||||||| ||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
32522118 |
gtaagtagttaaaattttaaccttacattttttacatttgatgctcacttggagagaatgatattatattagtatggcagactctttatctttacatt |
32522021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 32548738 - 32548669
Alignment:
| Q |
153 |
gagagaatgatattatattaggatggcagactctttatctttgcattctgatgtttgtgcatgtagtatag |
223 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||| ||||||||||| |
|
|
| T |
32548738 |
gagagaatgatattatattaggataccagactctttatttttgca-tctgatgtttgtgaatgtagtatag |
32548669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 92
Target Start/End: Complemental strand, 32548900 - 32548823
Alignment:
| Q |
15 |
ttgtcttgcagggattgaaagggctatatgcaggctttcctgctgggcttcttggcgcaactatttcatggagtttat |
92 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||| | ||||| ||||||| ||||| | |||||| |||||| |
|
|
| T |
32548900 |
ttgtcttgcagggattaagagggctatatgcaggctttcttcctggggttcttgggtcaactttatcatggggtttat |
32548823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 53
Target Start/End: Complemental strand, 32522200 - 32522168
Alignment:
| Q |
21 |
tgcagggattgaaagggctatatgcaggctttc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32522200 |
tgcagggattgaaagggctatatgcaggctttc |
32522168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University