View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_70 (Length: 239)
Name: NF10273_low_70
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 47884547 - 47884338
Alignment:
| Q |
1 |
cccacttccactgttgctctaaccttaaccacatgttgttttcccttaaatctaagatttgaaacacgatgattcaaatcaagtgaagggtttccagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47884547 |
cccacttccactgttgctctaaccttaacaacatgttgttttcccttaaatctaagatttgaaacacgatgattcaaatcaagtgaagggtttccagata |
47884448 |
T |
|
| Q |
101 |
tactagattgccttacaaggcttgaagcggccattgttgacttcaaaaccatggccatgttgaggtttttgctgggaacaaaacaaaacaatagagttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47884447 |
tactagattgccttacaaggcttgaagcggccattgttgacttcaaaaccatggccatgttgaggtttttgctgggaacaaaacaaaacaatagagttgt |
47884348 |
T |
|
| Q |
201 |
-ttgtgaagt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
47884347 |
gttgtgaagt |
47884338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University