View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_71 (Length: 239)
Name: NF10273_low_71
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 19587792 - 19587591
Alignment:
| Q |
1 |
ttgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatctttctcttccgtgtgttgttgagttttgttccagcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19587792 |
ttgctttgttgaaaattccgagtctgcgttctttttcatctaatttcttgatttcatgcatctttctcttccgtgtgttgttgagttttgttccagcatt |
19587693 |
T |
|
| Q |
101 |
ctttctctcagaagccctagcagtgttcttttcagacagttcacaattcttattcatgtttgtttcattcaacgtcactgatgatgaattatctgataac |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19587692 |
ctttctctc---------------------ttcagacagttcacaattcttattcatgtttgtttcattcaacatcactgatgatgaattatctgataac |
19587614 |
T |
|
| Q |
201 |
atagataaacaaaattaaaatag |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
19587613 |
atagataaacaaaattaaaatag |
19587591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 44 - 82
Target Start/End: Complemental strand, 12895207 - 12895169
Alignment:
| Q |
44 |
tttcttgatttcatgcatctttctcttccgtgtgttgtt |
82 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
12895207 |
tttcttgatttcatccttctttctcttccgtgtgttgtt |
12895169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University