View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10273_low_73 (Length: 239)
Name: NF10273_low_73
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10273_low_73 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 220
Target Start/End: Original strand, 6425793 - 6426002
Alignment:
| Q |
8 |
gagtgagatgaacaaattcaaggtgtgctactgtattgatagatcaccaaaggagcatatcattcgtgaagnnnnnnnggacaacgatgttgtggaattt |
107 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6425793 |
gagttagatgaacaaattcttggtgtgctactgtattgataga---ccaaaggagcatatcattcgtgaagtttttttggacaacgatgttgtggaattt |
6425889 |
T |
 |
| Q |
108 |
ctcatcaaaatccatctttcatactttctcaagctaatgaaaggatttagaggtttagtagtaataaagagtattggtttaagagtgtcatcgagtttat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6425890 |
ctcatcaaaatccatctttcatactttctcaagctaatgaaaggatttagaggtttagtagtaataaagagtataggtttaagagtgtcatcgagtttat |
6425989 |
T |
 |
| Q |
208 |
gttgatcgatact |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6425990 |
gttgatcgatact |
6426002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University