View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10273_low_73 (Length: 239)

Name: NF10273_low_73
Description: NF10273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10273_low_73
NF10273_low_73
[»] chr5 (1 HSPs)
chr5 (8-220)||(6425793-6426002)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 220
Target Start/End: Original strand, 6425793 - 6426002
Alignment:
8 gagtgagatgaacaaattcaaggtgtgctactgtattgatagatcaccaaaggagcatatcattcgtgaagnnnnnnnggacaacgatgttgtggaattt 107  Q
    |||| ||||||||||||||  ||||||||||||||||||||||   |||||||||||||||||||||||||       ||||||||||||||||||||||    
6425793 gagttagatgaacaaattcttggtgtgctactgtattgataga---ccaaaggagcatatcattcgtgaagtttttttggacaacgatgttgtggaattt 6425889  T
108 ctcatcaaaatccatctttcatactttctcaagctaatgaaaggatttagaggtttagtagtaataaagagtattggtttaagagtgtcatcgagtttat 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
6425890 ctcatcaaaatccatctttcatactttctcaagctaatgaaaggatttagaggtttagtagtaataaagagtataggtttaagagtgtcatcgagtttat 6425989  T
208 gttgatcgatact 220  Q
    |||||||||||||    
6425990 gttgatcgatact 6426002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University